Journal of Indian Society of Periodontology
Journal of Indian Society of Periodontology
Home | About JISP | Search | Accepted articles | Online Early | Current Issue | Archives | Instructions | SubmissionSubscribeLogin 
Users Online: 474  Home Print this page Email this page Small font size Default font size Increase font sizeWide layoutNarrow layoutFull screen layout


 
   Table of Contents    
CASE REPORT
Year : 2020  |  Volume : 24  |  Issue : 3  |  Page : 280-283  

Son of Sevenless-1 genetic status in an Indian family with nonsyndromic hereditary gingival fibromatosis


1 Department of Periodontology, KSR Institute of Dental Science and Research, Tiruchengode, Tamil Nadu, India
2 Department of Oral Pathology and Microbiology, KSR Institute of Dental Science and Research, Tiruchengode, Tamil Nadu, India
3 Department of Oral Pathology and Microbiology, Mahatma Gandhi Post Graduate Institute of Dental Sciences, Pondicherry, India
4 Department of Periodontology, Mahatma Gandhi Post Graduate Institute of Dental Sciences, Pondicherry, India

Date of Submission14-Jun-2019
Date of Decision29-Sep-2019
Date of Acceptance28-Nov-2019
Date of Web Publication27-Jan-2020

Correspondence Address:
Nitya Kala
Department of Periodontology, KSR Institute of Dental Science and Research, KSR Kalvi Nagar, Thokkavadi, Tiruchengode - 637 215, Tamil Nadu
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/jisp.jisp_329_19

Rights and Permissions
   Abstract 


Hereditary gingival fibromatosis (HGF) is a rare condition affecting the gingiva and may or may not be a clinical feature of other syndromes. It has been classified as a nondental biofilm-induced gingival disease. The pathogenesis of this condition has been poorly understood till date. Although different genetic mutations have been implicated to play a role, there is considerable interest on an addition mutation of Son of Sevenless-1 (SOS-1) gene. We report a case of a 27-year-old male patient who came to us with the complaint of enlarged gums of several years' duration. There were other members in his family who were similarly affected. After the clinical diagnosis of HGF was confirmed, the patient and his available family members were subjected to a genetic analysis for identification of mutation in SOS-1 gene, which turned out to be negative. The patient was treated with nonsurgical periodontal therapy and is under regular follow-up. To the best of our knowledge, this is the first study to assess SOS-1 mutation in an Indian family.

Keywords: Deoxyribonucleic acid sequencing, genetic analysis, gingival enlargement, hereditary gingival fibromatosis, son of sevenless-1


How to cite this article:
Kala N, Prasad H, Babu P, Kennedy Babu SP. Son of Sevenless-1 genetic status in an Indian family with nonsyndromic hereditary gingival fibromatosis. J Indian Soc Periodontol 2020;24:280-3

How to cite this URL:
Kala N, Prasad H, Babu P, Kennedy Babu SP. Son of Sevenless-1 genetic status in an Indian family with nonsyndromic hereditary gingival fibromatosis. J Indian Soc Periodontol [serial online] 2020 [cited 2020 Jun 2];24:280-3. Available from: http://www.jisponline.com/text.asp?2020/24/3/280/276962




   Introduction Top


The latest classification by the 2017 World Workshop on the Classification of Periodontal and Peri-Implant Diseases and Conditions includes hereditary gingival fibromatosis (HGF) under nondental biofilm-induced gingival diseases.[1] This is a benign, noninflammatory condition that is characterized by slowly progressing enlargement of the keratinized gingiva. This condition may be localized or generalized, diffuse or nodular, and is usually associated with eruption of permanent teeth.

HGF is a rare disorder affecting about 1:750,000 of the population. It may be nonsyndromic (isolated) or associated with other syndromes such as Ramon syndrome or Cowden syndrome.[2] HGF may be transmitted as a Mendelian trait, and both autosomal-dominant and autosomal-recessive transmission have been reported. Linkage studies have associated the nonsyndromic autosomal-dominant form of gingival fibromatosis to the mutation of Son of Sevenless-1 (SOS-1) gene in locus 2p21–22.[3]

We report a case of an Indian family with nonsyndromic HGF in whom the status of SOS-1 genetic mutation was assessed. To the best of our knowledge, this is the first report evaluating SOS-1 mutation in the Indian population.


   Case Report Top


A 27-year-old male patient reported to our department with the chief complaint of enlarged gums of several years' duration. He had noticed this enlargement when he was 8 years of age, and it had slowly progressed to the present size. He had lost his upper front teeth in a road traffic accident 3 months ago and wanted replacement of the same.

The patient was systemically healthy. On examination, Grade III generalized gingival enlargement was present on the buccal and palatal/lingual aspects of both the arches. The enlargement was diffuse involving the marginal, interdental, and attached gingivae [Figure 1]. He had fair oral hygiene. The surface of the swelling was smooth and lobulated in nature and coral pink in color with areas of melanin pigmentation. On palpation, it was nontender and firm in consistency with no evidence of pus discharge or bleeding on probing. Maxillary central and lateral incisors were missing. Remaining teeth were not tender on percussion and did not show mobility. An orthopantomograph revealed missing 12, 11, 21, and 22 with angular bone loss in relation to 26 and 27 [Figure 1]. The family history revealed that his mother, maternal grandfather, maternal uncle, and cousin had similar problems. The patient also revealed that he was not born out of consanguineous marriage. Based on the history and clinical features, a diagnosis of HGF with localized periodontitis in relation to 26 and 27 was made.
Figure 1: (a) Front view, (b) right lateral view, and (c) left lateral view of the lesions in the oral cavity showing diffuse gingival enlargement preoperatively; (d) Orthopantomograph showed missing maxillary incisors and angular bone loss in relation to 26 and 27

Click here to view


The patient's parents and siblings agreed to undergo oral examination on request. Examination of his mother revealed that she had a similar enlargement of gingiva along with poor oral hygiene. She was diagnosed as having a combined enlargement (HGF with inflammatory component). The patient's maternal grandfather and uncle were deceased. His cousin was unavailable for examination. The patient's father and siblings were examined, and they were found to be asymptomatic. A pedigree chart was constructed using our patient as the proband [Figure 2]. From the pedigree chart, we determined that this case was inherited in an autosomal-dominant pattern with heterozygous mutation.
Figure 2: Pedigree chart showing the pattern of inheritance of hereditary gingival fibromatosis in the patient's family

Click here to view


The patient was initially treated with nonsurgical periodontal therapy. This was then followed by sextant-wise external bevel gingivectomy under local anesthesia. An interval of 1 week was given between subsequent surgeries. Periodontal dressing was given with Coe-Pak (GC America Inc., Alsip, Illinois, USA). The excised tissue was stored in formalin and sent for histopathological examination. A removable partial denture replacing the missing anterior teeth was also fabricated and delivered [Figure 3]. The patient was recalled after 6 months for review and was found to be asymptomatic with no recurrence.
Figure 3: Postoperative images. (a) front view, (b) right lateral view, and (c) left lateral view. Partial denture to replace missing maxillary incisors was also delivered to the patient (d)

Click here to view


Histopathology of the excised tissue revealed hyperplastic parakeratinized stratified squamous epithelium of variable thickness and dense collagen fiber bundles showing hyalinization in many areas [Figure 4]. Focal areas of inflammatory cells were also noticed in the connective tissue. The histopathological findings were compatible with our diagnosis of gingival fibromatosis.
Figure 4: Histopathological examination showing surface epithelium (arrows) and dense fibrous connective tissue exhibiting hyalinization of collagen fibers (arrowheads) (H and E stain; ×200)

Click here to view


Since previous reports suggest the possibility of SOS-1 mutation in patients with HGF, genetic assessment was done for the patient and his parents for possible mutation in the SOS-1 gene. One milliliter of venous blood was collected from the cubital fossa and transferred to ethylenediaminetetraacetic acid-coated tubes. The genomic deoxyribonucleic acid (DNA) was extracted from 0.1 ml of peripheral blood using Qiagen DNA mini kit (Cat#12125), and the DNA was eluted in 50 μl of elution buffer.

SOS-1 gene has been reported to carry an insertion mutation at codon 1083.[3] In order to detect the presence of mutation, primers were designed (shown in bold letters) flanking the CCA codon as follows:

CCCCTAAAATCTCCTGGTGTTCGTCCATCAAACCCAA GACCAGGTACCATGAGGCATCCCACACCTCT GCAGCAGGAGCCAAGGAAAATTAGTTATAGTAG GATCCCTGAAAGTGAAACAGAAAGTACAGCATCT GCACCAAATTCTCCA AGAACACCGTTAACACCTCCGC CTGCTTCTGGTGCTTCCAGTACCACAGATGTTTGCAG TGTATTTGATTCCGATCATTCGAGCCCTTTTCAC.

The region was amplified under the following conditions: after an initial denaturation at 94°C for 4 min, the samples were subjected to 35 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s, with a final extension at 72°C for 5 min. Two microliter of the amplified product was then subjected to direct sequencing. We found that there was no mutation in the region of 2p21–22 either in the patient's or his parents' samples [Figure 5].
Figure 5: Results of deoxyribonucleic acid sequencing done in the patient as well as his parents. The top left panel shows the normal sequence of base pairs in the region of interest. The CCA codon where insertion mutation was suspected has been highlighted in larger size. Comparison of the normal sequence with the deoxyribonucleic acid sequences obtained from all three individuals revealed absence of any insertion mutation (raw deoxyribonucleic acid electropherogram files of all three individuals are available on request)

Click here to view



   Discussion Top


Goddard and Gross in 1856 reported the first case of hereditary gingival enlargement.[4] However, even after more than 160 years, the exact site of mutation and its form of inheritance is still inconclusive. Although most cases show an autosomal-dominant inheritance pattern, the penetrance of this trait is also found to be variable. Studies have revealed that penetrance varies widely, with offspring recurrence risk ranging from 7.8% to complete penetrance.[5] Some cases have shown to have an autosomal-recessive inheritance pattern. In certain cases, there may be no other family member with similar condition. This may be due to some new mutation; in which case, it is considered as idiopathic gingival fibromatosis. HGF has been shown to be associated in some cases with consanguineous marriage. Our patient showed an autosomal-dominant inheritance pattern with heterozygous mutation. There was no history of consanguineous marriage for two generations before him.

Clinically gingival fibromatosis appears as erythematous or nonerythematous enlargement. It may be localized or generalized. It is generally firm and nodular in consistency. It is rarely present in infancy and in deciduous dentition. It is usually associated with the eruption of permanent teeth. The enlargement is usually asymptomatic except in cases associated with periodontitis. When the overgrowth covers more than two-thirds of the tooth surface, there is difficulty in mastication, phonetics, esthetics, and maintenance of oral hygiene.

The histopathological findings of HGF are not consistent. Epithelium might show atrophy or in some cases hyperplasia with thin long rete ridges. The connective tissue shows dense bundles of collagen fibers that appear hyalinized in some areas. Diffuse chronic inflammation may also be present. Electron microscopic analysis of gingival connective tissue has been shown to have structural abnormalities in collagen fibrils. They may show variations in fibril diameter, presence of increased oxytalan fibers, and decreased elastic fibers. Our patient had hyperplastic parakeratinized stratified squamous epithelium of variable thickness and dense collagenous hyalinized fibers with mild focal areas of inflammatory cells in the connective tissue.

The biochemical alterations associated with HGF are still under research. Earlier studies revealed that the fibroblasts from patients of HGF showed slower proliferation. However, later studies on larger scale showed that these fibroblasts had increased proliferation rate when compared to that of normal people.[5] Coletta and Graner in their review of HGF have stated that there is an increased percentage of cells in both Gap-2/mitosis and synthetic phases of the cell cycle. Previous reports have found no changes in matrix metalloproteinase (MMP)-1, MMP-2, tissue inhibitor of metalloproteinase (TIMP)-1, and TIMP-2 levels. Transforming growth factor-β was found to be two times higher in HGF fibroblasts. The exact mechanism underlying the involvement of these growth factors and fibroblasts in HGF is unclear.[5]

Several studies have been done to analyze the exact mutation causing this condition. Hart et al. in 1998 conducted a multigenerational hereditary linkage study in a Brazilian family. They found that mutated SOS1 gene was present in the affected individuals.[3] Shashi et al. in 1999 identified two gene loci on short arm of chromosome 2 which might be responsible for this condition, one being in locus 2p21–22 and the other in locus 2p13–16.[6] This study was also done in the same Brazilian family. The mutation is reported to cause a frameshift and early termination of the protein, yielding a chimeric amino acid. This mutant SOS1 product contributes an increased and sustained activation of mitogen-activated protein kinase pathway in fibroblasts, which further leads to increased expression of cell cycle regulators and transcription factors, even in the absence of growth factors. Although SOS-1 mutation can also be found in Noonan syndrome, gingival overgrowth is not a feature of this syndrome. This is probably because the Noonan syndrome mutations are substitution mutations of SOS-1 and not insertion mutations.[7]

This mutation, however, is not present universally. Ye et al. in 2005 found that there was no mutation of SOS1 gene in a Chinese family with HGF.[8] Gawron et al. in 2017 also reported the absence of SOS1 mutation in a study involving two Polish families affected by HGF.[9] Therefore, genetic heterogenicity was suggested for HGF. It may be inferred that these mutations may vary based on the ethnicity of the population studied. The question of why the overgrowth phenotype of SOS-1 mutation in HGF is restricted only to gingival tissues is also still unanswered. In our study, we found that SOS1 mutation was absent in this Indian family with HGF.

Treatment options available include external or internal bevel gingivectomy or gingivoplasty based on the degree of involvement. Genetic counseling should be given. Recurrences after treatment have been reported. Ensuring maintenance of proper oral hygiene practice is important to avoid recurrence.


   Conclusion Top


HGF is a rare disorder affecting gingival tissues and may or may not be associated with other syndromes. Despite being a recognized entity for several decades, very little has been understood regarding its pathogenesis. Various genetic mutations have been proposed to cause the clinical effects of HGF. However, none have been established to have a positive and direct correlation with the disease. SOS-1 is one such gene, which has been considered to play a role in HGF. However, in our report of an Indian family with HGF, we did not find SOS-1 mutation in the proband or his parents. This is the first such report of assessment of SOS-1 mutation in the Indian population.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
   References Top

1.
Caton JG, Armitage G, Berglundh T, Chapple IL, Jepsen S, Kornman KS, et al. Anew classification scheme for periodontal and peri-implant diseases and conditions – Introduction and key changes from the 1999 classification. J Clin Periodontol 2018;45 Suppl 20:S1-8.  Back to cited text no. 1
    
2.
Duddu MK, Muppa R, Reddy GS, Reddy PV. Non syndromic gingival fibromatosis in a mild mental retardation child. Contemp Clin Dent 2012;3:S206-9.  Back to cited text no. 2
    
3.
Hart TC, Zhang Y, Gorry MC, Hart PS, Cooper M, Marazita ML, et al. Amutation in the SOS1 gene causes hereditary gingival fibromatosis type 1. Am J Hum Genet 2002;70:943-54.  Back to cited text no. 3
    
4.
Gross SD. Case of hypertrophy of the gums. Louisv Rev 1856;1:232-7.  Back to cited text no. 4
    
5.
Coletta RD, Graner E. Hereditary gingival fibromatosis: A systematic review. J Periodontol 2006;77:753-64.  Back to cited text no. 5
    
6.
Shashi V, Pallos D, Pettenati MJ, Cortelli JR, Fryns JP, von Kap-Herr C, et al. Genetic heterogeneity of gingival fibromatosis on chromosome 2p. J Med Genet 1999;36:683-6.  Back to cited text no. 6
    
7.
Jang SI, Lee EJ, Hart PS, Ramaswami M, Pallos D, Hart TC. Germ line gain of function with SOS1 mutation in hereditary gingival fibromatosis. J Biol Chem 2007;282:20245-55.  Back to cited text no. 7
    
8.
Ye X, Shi L, Cheng Y, Peng Q, Huang S, Liu J, et al. Anovel locus for autosomal dominant hereditary gingival fibromatosis, GINGF3, maps to chromosome 2p22.3-p23.3. Clin Genet 2005;68:239-44.  Back to cited text no. 8
    
9.
Gawron K, Bereta G, Nowakowska Z, Łazarz-Bartyzel K, Potempa J, Chomyszyn-Gajewska M, et al. Analysis of mutations in the SOS-1 gene in two Polish families with hereditary gingival fibromatosis. Oral Dis 2017;23:983-9.  Back to cited text no. 9
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5]



 

Top
   
 
  Search
 
  
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
    Abstract
     Introduction
     Case Report
     Discussion
     Conclusion
    References
    Article Figures

 Article Access Statistics
    Viewed78    
    Printed0    
    Emailed0    
    PDF Downloaded37    
    Comments [Add]    

Recommend this journal